The Marine Biologist at the Breakfast Table

The most popular blog post I’ve ever written, by far, is the one on how to make haplotype network figures in R. I’m not sure why this particular post receives so much traffic. But maybe I can recreate some of that success. Today I am going to show you how to make this figure using … More If you like making mitochondrial haplotype networks, you’ll also want to know how to make similar figures using multi-locus genotypes.

A very common task in Bioinformatics is to take two overlapping DNA sequences and “flash” them into a single sequence. You know, kinda like: Before: AGTCGGTACAAATTACACAGCATATGCTTTACTGTTAACCACA                                  GTTAACCACATGCGTAGCCACTTGCAATGTCTC After: AGTCGGTACAAATTACACAGCATATGCTTTACTGTTAACCACATGCGTAGCCACTTGCAATGTCTC But what program do you use to do it? There are a number of software packages that can do this kind of thing for you, … More It is easy to flash overlapping DNA sequences together using Biopython

If you’ve ever done any fisheries genetics, you’ve probably heard of Eric Anderson, who is a computational biologist at the NOAA southwest fisheries science center. His github page has over 100 repositories, many of which contain software programs that are broadly applicable. One of his more recent tools (co-written with Thomas Ng) is called Microhaplot: … More SNP haplotypes for Mixed-stock Fishery Analysis: Microhaplot to Rubias conversion in R

In any genetic data set it’s almost always desirable to find variants that are unique, or “private”, to a particular group. Most microsatellite-based papers report private alleles per population as part of their summary statistics, but now that genomic SNPs are the molecular marker in vogue, few papers I’ve seen tend to bother with private … More Identifying private SNPs in R

Once, when I was in college, I was sitting around with two friends talking about our future careers. One said: Someday when I’m a lawyer I’ll be able to offer you guys free legal advice. The other said: When I’m a dentist I’ll offer you free dental care. Then they both looked at me and … More Pairwise genetic relatedness and the birthday principle

So you found a SNP that is an Fst outlier in populations of your non-model organism. That’s great. But what do you do now? If I was your PhD supervisor, I’d tell you to take your Illumina read and BLAST search GenBank. Pray for a good hit. The genes matching your query might give you … More What to do about SNP X

Lately I’ve been struggling to find a good way to visually represent annotations for genomic loci. Specifically, I have a set of outlier loci SNPs that I need to describe in a way that is both reductive and hierarchical, for publication. More importantly, it has to look awesome, because everybody who reads my paper needs … More ooh… aah… TreeMap Figures

A recent paper, published in the journal of Molecular Ecology Resources, played on the name of a TV show for its title: The gist of the paper was this: if you use a reduced representation of a genome (such as a RAD-seq data set) to do genome-wide selection scans, you are taking a shot in … More I Dream of Genome