If you like making mitochondrial haplotype networks, you’ll also want to know how to make similar figures using multi-locus genotypes.

The most popular blog post I’ve ever written, by far, is the one on how to make haplotype network figures in R. I’m not sure why this particular post receives so much traffic. But maybe I can recreate some of that success. Today I am going to show you how to make this figure using … More If you like making mitochondrial haplotype networks, you’ll also want to know how to make similar figures using multi-locus genotypes.

It is easy to flash overlapping DNA sequences together using Biopython

A very common task in Bioinformatics is to take two overlapping DNA sequences and “flash” them into a single sequence. You know, kinda like: Before: AGTCGGTACAAATTACACAGCATATGCTTTACTGTTAACCACA                                  GTTAACCACATGCGTAGCCACTTGCAATGTCTC After: AGTCGGTACAAATTACACAGCATATGCTTTACTGTTAACCACATGCGTAGCCACTTGCAATGTCTC But what program do you use to do it? There are a number of software packages that can do this kind of thing for you, … More It is easy to flash overlapping DNA sequences together using Biopython

SNP haplotypes for Mixed-stock Fishery Analysis: Microhaplot to Rubias conversion in R

If you’ve ever done any fisheries genetics, you’ve probably heard of Eric Anderson, who is a computational biologist at the NOAA southwest fisheries science center. His github page has over 100 repositories, many of which contain software programs that are broadly applicable. One of his more recent tools (co-written with Thomas Ng) is called Microhaplot: … More SNP haplotypes for Mixed-stock Fishery Analysis: Microhaplot to Rubias conversion in R

Pairwise genetic relatedness and the birthday principle

Once, when I was in college, I was sitting around with two friends talking about our future careers. One said: Someday when I’m a lawyer I’ll be able to offer you guys free legal advice. The other said: When I’m a dentist I’ll offer you free dental care. Then they both looked at me and … More Pairwise genetic relatedness and the birthday principle

I Dream of Genome

A recent paper, published in the journal of Molecular Ecology Resources, played on the name of a TV show for its title: The gist of the paper was this: if you use a reduced representation of a genome (such as a RAD-seq data set) to do genome-wide selection scans, you are taking a shot in … More I Dream of Genome